RchiOBHm_Chr3g0470761
MYB Family

adenylyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
16719848 .. 16721126
1279 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43652

Sequence Viewer

Length: 219 bp
ATGGGGGGCGACAATCACACTGGGGTTAACTCTTTCTGTGAAAACAAGGCATTACAGTTGTTTAATTTGTTCTTTTCAGTACTTGTTCCAGGTGTCATGGATATCCCTCTGCCTCTTAGTAAATTGGCTATGCATCTGGTTAATCATGACGACAATTGTTTATCACTTATCTGGTATTATATCACTGCTATATGGTTTTGTTTGGTGCTATTGGAATGA

Protein Analysis

72

Amino Acids

8.16

Weight (kDa)

4.97

Isoelectric Point (pI)

35.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 81
AjnI CCWGG 1 cut(s) 88
BciT130I CCWGG 1 cut(s) 90
BmcAI AGTACT 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 90
BmrI ACTGGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 142
BmuI ACTGGG 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 25
BseBI CCWGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 25
BspHI TCATGA 1 cut(s) 145
BsrI ACTGG 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 116
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BtsI GCAGTG 1 cut(s) 183
BtsIMutI CAGTG 2 cut(s) 18, 183
CciI TCATGA 1 cut(s) 145
Csp6I GTAC 1 cut(s) 80
CviAII CATG 2 cut(s) 97, 146
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 1 cut(s) 116
Eco32I GATATC 1 cut(s) 103
EcoRII CCWGG 1 cut(s) 88
EcoRV GATATC 1 cut(s) 103
EcoT22I ATGCAT 1 cut(s) 135
FaeI CATG 2 cut(s) 100, 149
FaiI YATR 6 cut(s) 98, 131, 147, 180, 191, 193
FatI CATG 2 cut(s) 96, 145
Hin1II CATG 2 cut(s) 100, 149
HincII GTYRAC 1 cut(s) 28
HindII GTYRAC 1 cut(s) 28
HpaI GTTAAC 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 146
Hpy8I GTNNAC 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 133
HpyF3I CTNAG 1 cut(s) 116
Hsp92II CATG 2 cut(s) 100, 149
KspAI GTTAAC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 6, 75, 102, 122, 157
LweI GCATC 1 cut(s) 142
MfeI CAATTG 1 cut(s) 154
MluCI AATT 3 cut(s) 64, 122, 154
MnlI CCTC 2 cut(s) 117, 123
Mph1103I ATGCAT 1 cut(s) 135
MseI TTAA 3 cut(s) 27, 63, 141
MspR9I CCNGG 1 cut(s) 90
MunI CAATTG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 90
NlaIII CATG 2 cut(s) 100, 149
NsiI ATGCAT 1 cut(s) 135
PagI TCATGA 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 3 cut(s) 27, 63, 141
ScaI AGTACT 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 90
SetI ASST 1 cut(s) 94
SfaNI GCATC 1 cut(s) 142
SgeI CNNG 9 cut(s) 33, 58, 95, 101, 102, 109, 149, 158, 184
Sse9I AATT 3 cut(s) 64, 122, 154
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 57
TasI AATT 3 cut(s) 64, 122, 154
TatI WGTACW 1 cut(s) 79
Tru1I TTAA 3 cut(s) 27, 63, 141
Tru9I TTAA 3 cut(s) 27, 63, 141
TscAI CASTG 2 cut(s) 25, 190
TspRI CASTG 2 cut(s) 25, 190
ZrmI AGTACT 1 cut(s) 81
Zsp2I ATGCAT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.